CRISPR-Cas9 (Active) Protéine
Aperçu rapide pour CRISPR-Cas9 (Active) Protéine (ABIN3071563)
Antigène
Type de proteíne
Activité biologique
Origine
Source
Application
Pureté
-
-
Specificité
-
Activity test
Cas9 site-specific digestion:
We used in vitro digestion of a linearized plasmid to determine the activity of the Cas9 nuclease. It is a sensitive assay for GenCrispr Cas9 quality control. The linearized plasmid containing the target site:
(CATCATTGGAAAACGTTCTT)
can be digested with gRNA:
(CAUCAUUGGAAAACGUUCUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU)
and GenCrispr Cas9. Two cleavage DNA fragments (812 bp and 1898 bp) are determined by agarose gel electrophoresis. A 20 μL reaction in 1xCas9 Nuclease Reaction Buffer containing 160 ng linearized plasmid, 40 nM gRNA and 20 nM GenCrispr Cas9 for 2 hours at 37 °C results in 90 % digestion of linearized plasmid as determined by agarose gel electrophoresis. -
Attributs du produit
- GenCrispr Cas9 Nuclease is produced by expression in an E. colistrain carrying a plasmid encoding the Cas9 gene from Streptococcus pyogenes without nuclear localization signal (NLS).
-
Purification
- purified
-
Ingrédients
-
GenCrispr Cas9 Nuclease
10X Reaction Buffer
-
-
Vous souhaitez d'autres options pour ce Protein ?
!Découvrez nos protéines personnalisées prédéfinies et nos services de protéines sur mesure !Votre projet nécessite-t-il une personnalisation supplémentaire ? Contactez-nous et découvrez nos solutions protéiques sur mesure
-
-
-
Indications d'application
-
Screening for highly efficient and specific targeting gRNAs by in vitro DNA cleavage using Cas9 Nuclease from S. pyogenes
Highly purified Cas9 antigen could be used for specific antibody production. -
Restrictions
- For Research Use only
-
-
-
Concentration
- 0.2 mg/mL
-
Buffer
-
10X Reaction Buffer: 200 mM HEPES, 1M NaCl, 50 mM MgCl2, 1 mM EDTA, pH 6.5 at 25 °C.
1X Storage Buffer: 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50 % Glycerol pH 7.4 at 25 °C -
Agent conservateur
- Dithiothreitol (DTT)
-
Précaution d'utilisation
- This product contains Dithiothreitol (DTT): a POISONOUS AND HAZARDOUS SUBSTANCE which should be handled by trained staff only.
-
Stock
- -20 °C
-
Stockage commentaire
- GenCrispr Cas9 is supplied with 1X storage buffer (10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% Glycerol PH 7.4 at 25°C) and is recommended to be stored at -20°C.br/>Diluent Compatibility: Diluent Buffer: 300 mM NaCl, 10 mM Tris-HCl, 0.1 mM EDTA, 1 mM DTT, 500 μg/ml BSA and 50% glycerol. (pH 7.4 at 25°C).
-
-
- CRISPR-Cas9
-
Autre désignation
- Cas9 Nuclease
-
Sujet
- GenCrispr Cas9 Nuclease is the recombinant Streptococcus pyogenes Cas9 (wt) protein purified from E. coli that can be used for genome editing by inducing site-specific double stranded breaks in double stranded DNA. Cas9 protein forms a very stable ribonucleoprotein (RNP) complex with the guide RNA (gRNA) component of the CRISPR/Cas9 system. The RNP complex recognizes the target site by matching gRNA with the genomic DNA sequence and produces DNA breaks within 3 bases from the NGG PAM (Protospacer Adjacent Motif). With GenCrispr Cas9 nuclease, customers can screen for highly efficient gRNA in vitro using DNA cleavage assays. The high purity Cas9 protein can also be used for antibody production.
Antigène
-