Tel:
+49 (0)241 95 163 153
Fax:
+49 (0)241 95 163 155
E-Mail:
orders@anticorps-enligne.fr

CRISPR-Cas9 (Active) Protéine

Cette protéine Recombinant CRISPR-Cas9 est produite dans Escherichia coli (E. coli).
N° du produit ABIN3071564
206,69 €
Plus frais de livraison 40,00 € et TVA
50 μg
Destination: France
Envoi sous 8 à 12 jours ouvrables

Aperçu rapide pour CRISPR-Cas9 (Active) Protéine (ABIN3071564)

Antigène

CRISPR-Cas9

Type de proteíne

Recombinant

Activité biologique

Active

Origine

Streptococcus pyogenes

Source

  • 5
  • 3
Escherichia coli (E. coli)

Application

In vitro Cleavage Assay (IVCA), Antibody Production (AbP), Genome Editing with Engineered Nucleases (GEEN)

Pureté

> 95 % pure as determined by SDS-PAGE with Coomassie Blue detection.
  • Specificité

    Activity test
    Cas9 site-specific digestion:
    We used in vitro digestion of a linearized plasmid to determine the activity of the Cas9 nuclease. It is a sensitive assay for GenCrispr Cas9 quality control. The linearized plasmid containing the target site:
    (CATCATTGGAAAACGTTCTT)
    can be digested with gRNA:
    (CAUCAUUGGAAAACGUUCUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU)
    and GenCrispr Cas9. Two cleavage DNA fragments (812 bp and 1898 bp) are determined by agarose gel electrophoresis. A 20 μL reaction in 1xCas9 Nuclease Reaction Buffer containing 160 ng linearized plasmid, 40 nM gRNA and 20 nM GenCrispr Cas9 for 2 hours at 37 °C results in 90 % digestion of linearized plasmid as determined by agarose gel electrophoresis.

    Attributs du produit

    GenCrispr Cas9 Nuclease is produced by expression in an E. colistrain carrying a plasmid encoding the Cas9 gene from Streptococcus pyogenes without nuclear localization signal (NLS).

    Purification

    purified

    Ingrédients

    GenCrispr Cas9 Nuclease
    10X Reaction Buffer
  • Vous souhaitez d'autres options pour ce Protein ?

    !
    Découvrez nos protéines personnalisées prédéfinies et nos services de protéines sur mesure !

    Votre projet nécessite-t-il une personnalisation supplémentaire ? Contactez-nous et découvrez nos solutions protéiques sur mesure

  • Indications d'application

    Screening for highly efficient and specific targeting gRNAs by in vitro DNA cleavage using Cas9 Nuclease from S. pyogenes
    Highly purified Cas9 antigen could be used for specific antibody production.

    Restrictions

    For Research Use only
  • Concentration

    0.2 mg/mL

    Buffer

    10X Reaction Buffer: 200 mM HEPES, 1M NaCl, 50 mM MgCl2, 1 mM EDTA, pH 6.5 at 25 °C.
    1X Storage Buffer: 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50 % Glycerol pH 7.4 at 25 °C

    Agent conservateur

    Dithiothreitol (DTT)

    Précaution d'utilisation

    This product contains Dithiothreitol (DTT): a POISONOUS AND HAZARDOUS SUBSTANCE which should be handled by trained staff only.

    Stock

    -20 °C

    Stockage commentaire

    GenCrispr Cas9 is supplied with 1X storage buffer (10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% Glycerol PH 7.4 at 25°C) and is recommended to be stored at -20°C.br/>Diluent Compatibility: Diluent Buffer: 300 mM NaCl, 10 mM Tris-HCl, 0.1 mM EDTA, 1 mM DTT, 500 μg/ml BSA and 50% glycerol. (pH 7.4 at 25°C).
  • Antigène

    CRISPR-Cas9

    Autre désignation

    Cas9 Nuclease

    Sujet

    GenCrispr Cas9 Nuclease is the recombinant Streptococcus pyogenes Cas9 (wt) protein purified from E. coli that can be used for genome editing by inducing site-specific double stranded breaks in double stranded DNA. Cas9 protein forms a very stable ribonucleoprotein (RNP) complex with the guide RNA (gRNA) component of the CRISPR/Cas9 system. The RNP complex recognizes the target site by matching gRNA with the genomic DNA sequence and produces DNA breaks within 3 bases from the NGG PAM (Protospacer Adjacent Motif). With GenCrispr Cas9 nuclease, customers can screen for highly efficient gRNA in vitro using DNA cleavage assays. The high purity Cas9 protein can also be used for antibody production.
Vous êtes ici:
Chat with us!