Tel:
+49 (0)241 95 163 153
Fax:
+49 (0)241 95 163 155
E-Mail:
orders@anticorps-enligne.fr

CRISPR-Cas9 (Active) protein (NLS)

Cette protéine Recombinant CRISPR-Cas9 est exprimée dans Escherichia coli (E. coli).
N° du produit ABIN3071565
252,46 €
Plus frais de livraison 40,00 € et TVA
50 μg
Destination: France
Envoi sous 8 à 12 jours ouvrables

Aperçu rapide pour CRISPR-Cas9 (Active) protein (NLS) (ABIN3071565)

Antigène

CRISPR-Cas9

Type de proteíne

Recombinant

Activité biologique

Active

Origine

Streptococcus pyogenes

Source

  • 5
  • 2
Escherichia coli (E. coli)

Application

In vitro Cleavage Assay (IVCA), In vivo Gene Editing (IVGE), Microinjection (MI), RNA Electroporation (REP), Transfection (T)

Pureté

> 95 % pure as determined by SDS-PAGE with Coomassie Blue detection.
  • Purification/Conjugué

    NLS

    Specificité

    Activity test
    Cas9 site-specific digestion:
    We used in vitro digestion of a linearized plasmid to determine the activity of the Cas9 nuclease. It is a sensitive assay for GenCrispr Cas9 quality control. The linearized plasmid containing the target site:
    (CATCATTGGAAAACGTTCTT)
    can be digested with gRNA:
    (CAUCAUUGGAAAACGUUCUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU)
    and GenCrispr Cas9. Two cleavage DNA fragments (812 bp and 1898 bp) are determined by agarose gel electrophoresis. A 20 μL reaction in 1xCas9 Nuclease Reaction Buffer containing 160 ng linearized plasmid, 40 nM gRNA and 20 nM GenCrispr Cas9 for 2 hour at 37 °C results in 90 % digestion of linearized plasmid as determined by agarose gel electrophoresis.

    Attributs du produit

    GenCrispr Cas9-C-NLS is produced by expression in an E. coli strain carrying a plasmid encoding the Cas9 gene from Streptococcus pyogenes with a C terminal nuclear localization signal (NLS).

    Purification

    purified

    niveau d'endotoxine

    Endotoxin level is <0.1eu/ug test by gel-clot method: limit test

    Ingrédients

    GenCrispr Cas9-C-NLS
    10X Reaction Buffer
  • Vous souhaitez d'autres options pour ce Protein ?

    !
    Découvrez nos protéines personnalisées prédéfinies et nos services de protéines sur mesure !

    Votre projet nécessite-t-il une personnalisation supplémentaire ? Contactez-nous et découvrez nos solutions protéiques sur mesure

  • Indications d'application

    Screening the highly efficient and specific targeting gRNAs using in vitro DNA cleavage.
    In vivo gene editing combined with specific gRNA by electroporation or injection.

    Commentaires

    1. DNA-free: no external DNA added to system.
    2. High cleavage efficiency: NLS ensures the entry of Cas9 protein into nuclei.
    3. Low off target: transient expression of Cas9 nuclease.
    4. Time-saving: no need for transcription and translation.

    Restrictions

    For Research Use only
  • Concentration

    1 mg/mL

    Buffer

    10X Reaction Buffer: 200 mM HEPES, 1M NaCl, 50 mM MgCl2, 1 mM EDTA, pH 6.5 at 25 °C.
    1X Storage Buffer: 20 mM Tris, 600 mM NaCl, 0.1 mM EDTA,1 mM DTT,50 % Glycerol PH 7.4 at 25 °C)

    Agent conservateur

    Dithiothreitol (DTT)

    Précaution d'utilisation

    This product contains Dithiothreitol (DTT): a POISONOUS AND HAZARDOUS SUBSTANCE which should be handled by trained staff only.

    Stock

    -20 °C

    Stockage commentaire

    GenCrispr Cas9-C-NLS nuclease is supplied with 1X storage buffer (20 mM Tris, 600 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% Glycerol PH 7.4 at 25°C) and recommended to be stored at -20°C.
    Diluent Compatibility: Diluent Buffer: 300 mM NaCl, 10 mM Tris-HCl, 0.1 mM EDTA, 1 mM DTT, 500 μg/ml BSA and 50% glycerol. (pH 7.4 at 25°C).
  • Antigène

    CRISPR-Cas9

    Autre désignation

    Cas9-C-NLS Nuclease

    Sujet

    Cas9 nuclease is an RNA-guided endonuclease that can catalyze cleavage of double stranded DNA. This kind of targeted nuclease is a powerful tool for genome editing with high precision. Cas9 protein forms a very stable ribonucleoprotein (RNP) complex with the guide RNA (gRNA) component of the CRISPR/Cas9 system. The Cas9 RNP complex can localize to the nucleus immediately upon entering the cell with the addition of a nuclear localization signal (NLS). There is no requirement for transcription and translation compared with mRNA or plasmid systems. Additionally, the Cas9 RNP complex is rapidly cleared from the cell minimizing the chance of off-target cleavage when compared to other systems (Kim, et al. 2014). This DNA-free system avoids the risk of inserting foreign DNA into the genome, which can be quite useful for gene editing-based disease therapy. GenScript has developed a Cas9-C-NLS nuclease which contains a nuclear localization sequence (NLS) on the C-terminus of the protein to meet all the researchers' requirements (e.g. in vitro cleavage assay, RNP complex transfection, and micro injection).
Vous êtes ici:
Chat with us!