CRISPR-Cas9 (Active) Protéine

N° du produit ABIN3071566

Protéine Recombinant exprimée dans Escherichia coli (E. coli).

Aperçu rapide pour CRISPR-Cas9 (Active) Protéine (ABIN3071566)

Antigène: CRISPR-Cas9

Type de proteíne: Recombinant

Activité biologique: Active

Origine: Streptococcus pyogenes

Source: Escherichia coli (E. coli)

Application: In vitro Cleavage Assay (IVCA), In vivo Gene Editing (IVGE), Microinjection (MI), RNA Electroporation (REP), Transfection (T)

Pureté: > 95 % pure as determined by SDS-PAGE with Coomassie Blue detection.

Détail du produit

Specificité: Activity test
Cas9 site-specific digestion:
We used in vitro digestion of a linearized plasmid to determine the activity of the Cas9 nuclease. It is a sensitive assay for GenCrispr Cas9 quality control. The linearized plasmid containing the target site:
(CATCATTGGAAAACGTTCTT)
can be digested with gRNA:
(CAUCAUUGGAAAACGUUCUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU)
and GenCrispr Cas9. Two cleavage DNA fragments (812 bp and 1898 bp) are determined by agarose gel electrophoresis. A 20 μL reaction in 1xCas9 Nuclease Reaction Buffer containing 160 ng linearized plasmid, 40 nM gRNA and 20 nM GenCrispr Cas9 for 2 hour at 37 °C results in 90 % digestion of linearized plasmid as determined by agarose gel electrophoresis.

Attributs du produit: GenCrispr Cas9-C-NLS is produced by expression in an E. coli strain carrying a plasmid encoding the Cas9 gene from Streptococcus pyogenes with a C terminal nuclear localization signal (NLS).

Purification: purified

niveau d'endotoxine: Endotoxin level is <0.1eu/ug test by gel-clot method: limit test

Ingrédients: GenCrispr Cas9-C-NLS
10X Reaction Buffer

Information d'application

Indications d'application: Screening the highly efficient and specific targeting gRNAs using in vitro DNA cleavage.
In vivo gene editing combined with specific gRNA by electroporation or injection.

Commentaires:

1. DNA-free: no external DNA added to system.
2. High cleavage efficiency: NLS ensures the entry of Cas9 protein into nuclei.
3. Low off target: transient expression of Cas9 nuclease.
4. Time-saving: no need for transcription and translation.

Restrictions: For Research Use only

Stockage

Concentration: 4 mg/mL

Buffer: 10X Reaction Buffer: 200 mM HEPES, 1M NaCl, 50 mM MgCl2, 1 mM EDTA, pH 6.5 at 25 °C.
1X Storage Buffer: 20 mM Tris, 600 mM NaCl, 0.1 mM EDTA,1 mM DTT,50 % Glycerol PH 7.4 at 25 °C)

Agent conservateur: Dithiothreitol (DTT)

Précaution d'utilisation: This product contains Dithiothreitol (DTT): a POISONOUS AND HAZARDOUS SUBSTANCE which should be handled by trained staff only.

Stock: -20 °C

Stockage commentaire: GenCrispr Cas9-C-NLS nuclease is supplied with 1X storage buffer (20 mM Tris, 600 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% Glycerol PH 7.4 at 25°C) and recommended to be stored at -20°C.
Diluent Compatibility: Diluent Buffer: 300 mM NaCl, 10 mM Tris-HCl, 0.1 mM EDTA, 1 mM DTT, 500 μg/ml BSA and 50% glycerol. (pH 7.4 at 25°C).

Détail du antigène

Antigène: CRISPR-Cas9

Autre désignation: Cas9-C-NLS Nuclease

Sujet: Cas9 nuclease is an RNA-guided endonuclease that can catalyze cleavage of double stranded DNA. This kind of targeted nuclease is a powerful tool for genome editing with high precision. Cas9 protein forms a very stable ribonucleoprotein (RNP) complex with the guide RNA (gRNA) component of the CRISPR/Cas9 system. The Cas9 RNP complex can localize to the nucleus immediately upon entering the cell with the addition of a nuclear localization signal (NLS). There is no requirement for transcription and translation compared with mRNA or plasmid systems. Additionally, the Cas9 RNP complex is rapidly cleared from the cell minimizing the chance of off-target cleavage when compared to other systems (Kim, et al. 2014). This DNA-free system avoids the risk of inserting foreign DNA into the genome, which can be quite useful for gene editing-based disease therapy. GenScript has developed a Cas9-C-NLS nuclease which contains a nuclear localization sequence (NLS) on the C-terminus of the protein to meet all the researchers' requirements (e.g. in vitro cleavage assay, RNP complex transfection, and micro injection).