Tel:
+49 (0)241 95 163 153
Fax:
+49 (0)241 95 163 155
E-Mail:
orders@anticorps-enligne.fr

CRISPR-Cas9 (Active) Protéine

Origine: Streptococcus pyogenes Hôte: Escherichia coli (E. coli) Recombinant > 95 % pure as determined by SDS-PAGE with Coomassie Blue detection. IVCA, AbP, GEEN Active
N° du produit ABIN3071564
  • Antigène
    CRISPR-Cas9
    Type de proteíne
    Recombinant
    Activité biologique
    Active
    Origine
    Streptococcus pyogenes
    Source
    • 1
    Escherichia coli (E. coli)
    Application
    In vitro Cleavage Assay (IVCA), Antibody Production (AbP), Genome Editing with Engineered Nucleases (GEEN)
    Specificité
    Activity test
    Cas9 site-specific digestion:
    We used in vitro digestion of a linearized plasmid to determine the activity of the Cas9 nuclease. It is a sensitive assay for GenCrispr Cas9 quality control. The linearized plasmid containing the target site:
    (CATCATTGGAAAACGTTCTT)
    can be digested with gRNA:
    (CAUCAUUGGAAAACGUUCUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU)
    and GenCrispr Cas9. Two cleavage DNA fragments (812 bp and 1898 bp) are determined by agarose gel electrophoresis. A 20 μL reaction in 1xCas9 Nuclease Reaction Buffer containing 160 ng linearized plasmid, 40 nM gRNA and 20 nM GenCrispr Cas9 for 2 hours at 37 °C results in 90 % digestion of linearized plasmid as determined by agarose gel electrophoresis.
    Attributs du produit
    GenCrispr Cas9 Nuclease is produced by expression in an E. colistrain carrying a plasmid encoding the Cas9 gene from Streptococcus pyogenes without nuclear localization signal (NLS).
    Purification
    purified
    Pureté
    > 95 % pure as determined by SDS-PAGE with Coomassie Blue detection.
    Ingrédients
    GenCrispr Cas9 Nuclease
    10X Reaction Buffer
  • Indications d'application
    Screening for highly efficient and specific targeting gRNAs by in vitro DNA cleavage using Cas9 Nuclease from S. pyogenes
    Highly purified Cas9 antigen could be used for specific antibody production.
    Restrictions
    For Research Use only
  • Concentration
    0.2 mg/mL
    Buffer
    10X Reaction Buffer: 200 mM HEPES, 1M NaCl, 50 mM MgCl2, 1 mM EDTA, pH 6.5 at 25 °C.
    1X Storage Buffer: 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50 % Glycerol pH 7.4 at 25 °C
    Agent conservateur
    Dithiothreitol (DTT)
    Précaution d'utilisation
    This product contains Dithiothreitol (DTT): a POISONOUS AND HAZARDOUS SUBSTANCE which should be handled by trained staff only.
    Stock
    -20 °C
    Stockage commentaire
    GenCrispr Cas9 is supplied with 1X storage buffer (10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% Glycerol PH 7.4 at 25°C) and is recommended to be stored at -20°C.br/>Diluent Compatibility: Diluent Buffer: 300 mM NaCl, 10 mM Tris-HCl, 0.1 mM EDTA, 1 mM DTT, 500 μg/ml BSA and 50% glycerol. (pH 7.4 at 25°C).
  • Antigène
    CRISPR-Cas9
    Autre désignation
    Cas9 Nuclease
    Sujet
    GenCrispr Cas9 Nuclease is the recombinant Streptococcus pyogenes Cas9 (wt) protein purified from E. coli that can be used for genome editing by inducing site-specific double stranded breaks in double stranded DNA. Cas9 protein forms a very stable ribonucleoprotein (RNP) complex with the guide RNA (gRNA) component of the CRISPR/Cas9 system. The RNP complex recognizes the target site by matching gRNA with the genomic DNA sequence and produces DNA breaks within 3 bases from the NGG PAM (Protospacer Adjacent Motif). With GenCrispr Cas9 nuclease, customers can screen for highly efficient gRNA in vitro using DNA cleavage assays. The high purity Cas9 protein can also be used for antibody production.
Vous êtes ici:
Blank Blank Blank Blank
Blank Blank Blank Blank
Support technique